grain_icon  Literature Database   |  Rice Genetics Newsletters   >  Volume 20 Contents  





9. Mapping of GOLIATH, a new gene controlling embryo size in rice
  G. TARAMINO1, J. ALLEN1, S-K. HONG1*, N. NAGASAWA1, Y. NAGATO2 and H. SAKAI1

1) DuPont, Agriculture and Nutrition, Delaware Technology Park 200, 1 Innovation Way, Newark, DE 19711, USA
2) Graduate School of Agricultural and Life Science, University of Tokyo, Tokyo 113-8657, Japan
*) Present Address: Kangwon National University, College of Agriculture and Life Sciences, Chuncheon, Kangwon-Du, 200-701, Korea

Our interest in the genetic mechanisms underlying the size of embryo and its relationship with the endosperm size in rice has brought us to the identification and analysis of a new single gene recessive mutant having an enlarged embryo, which we named goliath (go). The go mutation was induced in the background of the japonica cultivar, Kinmaze, through the mutagenesis using NMU. The whole seed and cross sections of the mature embryo of the go mutant are shown in Figure 1 and 2, respectively. As these figures show, the large embryo size of go is primarily due to an increased number of cells in the scutellum. Morphological aberrations were often observed in the structure of embryonic organs including shoot and radicle, possibly correlated with the lack of germination and regeneration capability of the mutant. Beside go, giant embryo (ge) mutations have been known for conferring a similar phenotype with enlarged embryo and reduced endosperm structures (Hong et al. 1996). The

allelism test between ge homozygous plants and go heterozygote plants demonstrated that the two mutations complemented with each other, showing that go and ge loci correspond to two distinct genes.

Since the go mutation is lethal and can be maintained only in a heterozygote condition, we adopted the following strategy to identify molecular markers flanking the GO gene. To generate a mapping population, go1 heterozygous (japonica rice cv. Kinmaze) plants were chosen as the female parent and indica rice cultivar Kasalath as the male parent. The resulted F1 plants were grown and the ones that segregated go mutants in F2 seed were selected for mapping. Homozygous go seeds were sterilized and placed on MS media. Callus cells induced after a month of incubation were used for DNA extraction and mapping. To obtain F2 segregants that carried recombination breakpoints near the go locus, PCR-based DNA markers were developed. Several CAPS and SSR markers were produced based on public sequences of BAC clones of known map positions released by the Rice Genome Project Group (RGP). SSR markers were also designed based on BAC-end sequences released by the Clemson University Genome Initiative (CUGI). Using 32 homozygous go seeds, we mapped the mutant locus on Chromosome 3 between a CAPS marker (C3-145) and an SSR marker (SSR45), which were separated by the genetic distance of approximately 10 cM (Fig 3). In particular, the SSR 45

primers (SSR 45F: CTCACGATCCTTACCTTGAATTG and SSR 45R: ATCCACTGTGTGCGTTTCTAGTT) were designed based on BAC end sequences of the CUGI clone OSJNBa0005B12. This primer set amplified a region of 203 bp flanking the tri-nucleotide repeat (AAG)66 showing polymorphism between indica and japonica cultivars. CAPS marker C3-145 ( C3-145F: ACGGGTTGTTTCACTTACAGGT and C3-145R: TGTTTACCAAACTAGCCACCCAT) was designed based on the sequence of clone OSJNBa0091J19, mapping at 145.6 cM of Chromosome 3.

This primer set amplified a region of 1128 bp, showing polymorphism between indica and japonica cultivars after the cleavage with the HhaI restriction enzyme.

When using these two primers on 85 go seeds, we obtained 6 recombinants with marker CAPS C3-145 and a different set of 7 recombinants with marker SSR45, indicating that go was localized between these two markers. Further recombinant screens and sequence analysis will allow us to isolate a candidate gene responsible for the go phenotype.

References

Hong, S.-K, H. Kitano, H. Satoh and Y. Nagato. 1996. How is embryo size genetically regulated in rice? Development 122: 2051-2058.



  

Last modified: Mon Nov 1 00:06:46 2004