After fertilization, cells of the embryo and endosperm undergo distinct processes of proliferation and differentiation. During the development, these two tissues appear to interact with each other to determine their size and form a proper seed structure. As part of our effort in understanding genetic control of the embryo/endosperm size, we localized the giant embryo (ge) locus to a high-resolution map by identifying a contig of genomic BAC clones that covered the gene region.

Previously, the ge locus was mapped to the long arm of chromosome 7 by analyzing linkages to other visible mutant loci (Satoh and Iwata, 1990). Further, it was mapped to a region around 88 cM (Koh et al. 1996). According to the RGP map (Harushima et al. 1998), this region with a 5 cM-long interval did not contain any physical marker nor genomic clones including PACs and YACs. In order to map the ge locus precisely, we created mapping populations by crossing ge-3 and ge-5 with an indica cultivar, Kasalath. The F1 plants were selfed to produce F₂ progeny. F₂ plants homozygous for the recessive ge mutations were screened based on the large embryo phenotype and were used for mapping.

To map the ge locus, we first converted two RFLP markers of RGP, C847 and B2F2, into PCR-based markers. The primers for B2F2 were designed using the rice EST sequence (C73451). Based on the single nucleotide polymorphisms we found, we designed a primer set for PCR genotyping: One primer, C73451-1 (5'TAGCTTTAGAGTACATTTCTTAGATACGGCA3'), was complementary to the indica-specific base at its 3' end. In combination with another primer, C73451-2 (5'TTACTTTGAGCGTGCCAAGCAGTATAATTTCT3'), DNA was amplified only from Kasalath but not from the mutant background. For C847, we designed the primers, C847-1 (5'GTTTCATAATGAAATTGACTCTTTTTCAGTAA3') and C847-2 (5'GCAAATAATTATTTCTATATACAGGACAGGC3'), to amplify only the Kasalath recombinant genotype. A typical PCR reaction (30 microl) was carried out with 5 pmole of each primer in a thermal cycle condition: 95C 10 min, 94C 30 sec, 56C 30 sec, 72C 5 min, repeating step 2 to 4 forty times. Young leaf tissues obtained from germinating F₂ ge plants were subjected to direct PCR reactions. By analyzing 734 F₂ ge mutants, we identified 27 recombinants between C73451 and ge and 59 recombinants between C847 and ge. The number of cross overs indicates that the genetic distance between the ge locus and B2F2 is 1.8 + or - 0.4 cM and C847 is 4.0 + or - 0.5 cM (Fig. 1). 10 and 16 recombinants identified by C847 and B2F2, respectively, were further used for the mapping of the ge locus with other markers.

We then recovered end sequences of the YAC clone, Y4052, which was shown to cover the genomic region around W146, by applying the vectorette PCR method. Consistent with the RGP data, the number of recombinants at the 3' end of Y4052 was 8 out of 10 recombinants that were identified by screening with the C847 marker. On the other hand, the 5' end of Y4052 identified 3 recombinants, which corresponded to a distance of approximately 1.2 cM to the ge locus. We chose the 5'end as a start point of our chromosome walk toward the GE gene. We screened BAC libraries, LM/TQ libraries from Texas A&M (http://hbz.tamu.edu/bacindex.html) and YT library (Bryan et al., 2000) for the purpose. The process of our chromosome walk is shown in Fig.1. Using the 5' end probe of Y4052, we obtained two clones, TQ-22-7E and TQ-1-19L. The right end of TQ-1-19L was used to isolate other overlapping BAC clones, LM-10-22N and LM-15-7P. The left end of LM-15-7P was used to isolate two other overlapping BACs, LM-3-6B and LM-10-11O. The left end of LM-3-6B was further used to isolate over-

lapping BACs, LM-20-4D, TQ-24-15J and YT14-3-10. Then, an 1.6 kb-long HindIII fragment of LM-20-4D was used to isolate TQ-18-1I, whose right end overlapped with LM-20-1I, LM-15-20J and LM-4-12E. The PCR analysis with a B2F2-specific primer set revealed that the last three BACs contained the marker locus. By using BAC ends and subclones, we further mapped the ge locus in the vicinity of the region covered by LM-20-4D and TQ-24-15J.

The contig of 13 BAC clones encompassed a 3 cM-long gap between B2F2 and the 5'end of Y4052. The physical distance of this 3 cM-long region was 500 kb at most. The recombination frequency of this region (<170 kb / cM) indicates that this region is highly recombinogenic in comparison to the genome-wide recombination frequency, which is (430 Mb/1530 cM = 281 kb / cM) according to RGP. Genomic regions with high recombination frequencies, similar to the one around the ge locus, could correlate with large gaps of genetic markers, which are evident even in a high-density linkage map (Harushima et al. 1998).

Acknowledgement

We thank Dr. Takuji Sasaki for providing the YAC clone, Y4052.

References

Bryan, G. T., K. S. Wu, L. Farrall, Y. Jia, H. P. Hershey, S. A. McAdams, K. N. Faulk, G. K. Donaldson, R. Tarchini, and B. Valent, 2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12: 2033-2046.

Harushima, Y., M. Yano, A. Shomura, M. Sato, T. Shimano, Y. Kuboki, T. Yamamoto, S. Y. Lin, B. A. Antonio, A. Parco, H. Kajiya, N. Huang, K. Yamamoto, Y. Nagamura, N. Kurata, G. S. Khush, and T. Sasaki, 1998. A highdensity rice genetic linkage map with 2275 markers using a single F₂ population. Genetics 148: 479-494.

Koh, H.-J., M.-H. Heu and S. R. McCouch, 1996. Molecular mapping of the ge^s gene controlling the super-giant embryo character in rice (Oryza sativa L.). TAG 93: 257-261.

Satoh, H. and N. Iwata, 1990. Linkage analyses in rice: On the three mutant loci controlling endosperm properties, ge (giant embryo), du-4 (dull endosperm-4) and flo-1 (floury endosperm-1). Japan. J. Breed. 37 (Suppl. 1): 338- 339.