Vol. 20 >B. Research Notes>III. Genetics of morphological traits |
9. | Mapping of GOLIATH, a new gene controlling embryo size in rice |
G. TARAMINO1, J. ALLEN1, S-K. HONG1*,
N. NAGASAWA1, Y. NAGATO2 and H. SAKAI1 1) DuPont, Agriculture and Nutrition, Delaware Technology Park 200, 1 Innovation Way, Newark, DE 19711, USA 2) Graduate School of Agricultural and Life Science, University of Tokyo, Tokyo 113-8657, Japan *) Present Address: Kangwon National University, College of Agriculture and Life Sciences, Chuncheon, Kangwon-Du, 200-701, Korea |
Our interest in the genetic mechanisms underlying the size of embryo and its relationship with the endosperm size in rice has brought us to the identification and analysis of a new single gene recessive mutant having an enlarged embryo, which we named goliath (go). The go mutation was induced in the background of the japonica cultivar, Kinmaze, through the mutagenesis using NMU. The whole seed and cross sections of the mature embryo of the go mutant are shown in Figure 1 and 2, respectively. As these figures show, the large embryo size of go is primarily due to an increased number of cells in the scutellum. Morphological aberrations were often observed in the structure of embryonic organs including shoot and radicle, possibly correlated with the lack of germination and regeneration capability of the mutant. Beside go, giant embryo (ge) mutations have been known for conferring a similar phenotype with enlarged embryo and reduced endosperm structures (Hong et al. 1996). The allelism test between ge homozygous plants and go
heterozygote plants demonstrated that the two mutations complemented with
each other, showing that go and ge loci correspond to two
distinct genes. primers (SSR 45F: CTCACGATCCTTACCTTGAATTG and SSR 45R: ATCCACTGTGTGCGTTTCTAGTT)
were designed based on BAC end sequences of the CUGI clone OSJNBa0005B12.
This primer set amplified a region of 203 bp flanking the tri-nucleotide
repeat (AAG)66 showing polymorphism between indica and
japonica cultivars. CAPS marker C3-145 ( C3-145F: ACGGGTTGTTTCACTTACAGGT
and C3-145R: TGTTTACCAAACTAGCCACCCAT) was designed based on the sequence
of clone OSJNBa0091J19, mapping at 145.6 cM of Chromosome 3. |
Vol. 20 >B. Research Notes>III. Genetics of morphological traits |