The embryo and endosperm accumulate seed storage molecules distinct to their tissues, e.g. starch is predominantly produced in the endosperm and the embryo serves as the tissue that accmulates oil. Due to this partitioning, the size of the embryo and endosperm largely affects nutritional balance of crop grains. The isolation of several mutants with aberrant embryo/endosperm size in rice indicates that there is a genetic network regulating the size balance between these seed tissues. Among these mutants, giant embryo (ge) mutants produce a large embryo while the size of the endosperm is reduced correspondingly, and reduced embryo1 (re1) and reduced embryo2-1 (re2-1) mutants form a large endosperm, reducing the embryo size correspondingly, which were identified in the M₂ population of cv. Taichung 65 mutagenized with MNU (Satoh and Omura 1981, Hong et al. 1996). Hence the overall seed size is not significantly affected in these mutants, it is speculated that the embryo/endosperm size is controlled through the interaction between the embryo and endosperm. In order to understand the genetic system that regulates communication between these tissues, we initiated the mapping of embryo/endosperm size genes (Nagasawa et al. 2003). Here we report the isolation of an additional re2 allele and the genetic mapping of the RE2 locus.

In order to obtain new re2 alleles, we produced a mutant population through inducing genetic variants through tissue culturing (Hirochika et al. 1996). We induced callus cells of the cultivar Nipponbare on CHU-N6 medium (CHU-N6 basal salt, N6 vitamin, 300mg/L casein hydrolysate, 30g/L sucrose, 100mg/L myo-inositol, 0.2mg/ml 2.4-D, and 0.3% gelrite). After about 1 month, induced callus cells were transferred to CHU-N6 liquid medium and cultured in the rotary shaker at 140 rpm. The medium was exchanged every week and callus tissues were filtered through a 1mm steel mesh every second weeks. After 3 month incubation, we transferred calli onto MS medium (MS basal salt, MS-vitamin, 100mg/L myo-inositol, 2g/L casaine hydrolase, 30g/L sorbitol, 30g/L sucrose, 3g/L gelrite, 0.2 mg/L NAA and 2mg/L Kinetin) and incubated them under the light to induce shoots and roots. The regenerated plants were transferred to the soil. About 6000 M₁ (R₀) plants were grown on the paddy field and produced M₂ seeds were screened for embryo size mutants. We obtained one reduced embryo mutant and the allelism test showed that this mutant was allelic to re2-1. Since another reduced embryo mutant kindly provided by Dr. M. Matsuoka also showed the allelic relationship to re2-1 and designated as re2-2, we named our mutant re2-3. Both mutants showed a phenotype indistinguishable to re2-1.

In order to obtain populations for mapping the RE2 locus, a re2-1 mutant plant was crossed with an Indica cultivar, Kasalath. F₁ plants were self fertilized to produce the F₂ seed. We screened F₂ seed with the reduced embryo phenotype and used these re2 homozygous F₂ for genetic mapping. The re2-1 seeds were germinated on MS medium (MS basal salt (SIGMA), MS-vitamin(SIGMA), 3g/L gelrite) and incubated in a growth chamber for 3 weeks under a lighting condition. When mutants were at third leaf stage on plates, we sampled 5-10mm length of leaf tissues and used for direct PCR reactions as described in Klimyuk et al. 1993 with
a modification of extending the sample boiling time to four minutes at the neutralization step.

By analyzing F₂ progeny, the RE2 locus was mapped to the short arm of chromosome 10, showing a linkage to one of our CAPS markers, C10 15.9 CAPS. The marker C10 15.9 CAPS was designed based on the sequence of BAC OSJNBa0034E23 (15.9-7F: CCAACCACCATAACCATCATTC, 15.9-8R: CTATGCATCTCCCATATAAGCCA), which produced polymolphic DNA fragments between Taichung65 and Kasalath when amplified DNA was digested with MspI. For further mapping with a higher resolution, we designed two additional markers using the available genomic sequence information. C10 7.7 Hpy CAPS marker (C10-
7.7 2 HPYIVF: ATTGTCTCGTGTGACAGCGC, C10-7.7 2 HPYIVR: CCGCAATTAATATTCCGAGC), which was designed based on the sequence of BAC OSJNBa0036D19, produced polymorphic DNA fragments between Taichung65 and Kasalath when amplified DNA was digested with HpyCH4IV. The second marker C10 11.5 CAPS (C10 11.5 HpyV, AAAGTGTGGTAGGTGTCATCCAGTTG C10 11.5-9, GCCACATGATCATCCACTACCAATG), which was designed based on the sequence of BAC OSJNBa0071I20, produced polymorphic DNA fragments between Taichung65 and Kasalath when amplified DNA was digested with HpyCH4V. The C10 7.7 Hpy CAPS marker is localized on the BAC that contains the RGP marker R1933 and the C10 11.5 CAPS marker is on the BAC that contains the RGP marker C1757S.

Using these markers, we analyzed 308 F₂ mutant progeny for mapping of the re2 locus. We

found 29 recombinants between C10 15.9 maker and re2, 10 recombinants between C10 11.5 and re2, and 16 recombinants between C10 7.7 and re2. The number of recombination indicates that the genetic distances between the RE2 locus and markers, C10 7.7, C10 11.5 and C10 15.9 are 2.6 + or - 0.6cM, 2.6 + or - 0.8 cM and 5.3 + or - 0.9 cM, respectively. The region to which the RE2 gene has been mapped contains 9 overlapping BAC clones with one gap (Chen et al. 2002).

Reference

Hirochika, H. , K. Sugimoto, Y. Otsuki, H. Tsugawa and M. Kanda. 1996. Retrotransposons of rice involved in mutations induced by tissue culture. Proc. Natl. Acad. Sci. USA 93: 7783-7788.

Hong, S.-K., H. Kitano, H. Satoh and Y. Nagato. 1996. How is embryo size genetically regulated in rice? Development 122: 2051-2058.

Klimyuk, V. I., B. J. Carroll, C. M. Thomas and J. D. Jones. 1993. Alkali treatment for rapid preparation of plant material for reliable PCR analysis. Plant J. 3(3): 493-494.

Nagasawa, N., Y. Nagato and H. Sakai. 2003. Physical mapping of the GIANT EMBRYO gene in highly recombinogenic region of chromosome 7. Rice Genetics Newsletter 19: 45-47.

Satoh, H. and Omura, T. 1981. New endosperm mutations induced by chemical mutagens in rice, Oryza sativa. Japan. J. Breed. 31: 316-326.

M. Chen, G. Presting, W. B. Barbazuk, J. L. Goicoechea, B. Blackmon, G. Fang, H. Kim, D. Frisch, Y. Yu, S. Sun, S. Higingbottom, J. Phimphilai, D. Phimphilai, S. Thurmond, B. Gaudette, P. Li, J. Liu, J. Hatfield, D. Main, K. Farrar, C. Henderson, L. Barnett, R. Costa, B. Williams, S. Walser, M. Atkins, C. Hall, M. A. Budiman, J. P. Tomkins, M. Luo, I. Bancroft, J. Salse, F. Regad, T. Mohapatra, N. K. Singh, A. K. Tyagi, C. Soderlund, R. A. Dean and R. A. Wing. (2002). An integrated physical and genetic map of the rice genome. Plant Cell 14: 537-545.