ID | 4308 |
---|---|
Name | BE435260 (GenBank Accession ) |
Synonyms (0) | None. |
GenBank GI | 9433103 |
GenBank Version | BE435260.1 |
Type | EST |
Species | Solanum lycopersicum (Tomato) [ GR_tax:018113 ] |
Germplasm | |
Description | EST406338 tomato breaker fruit, TIGR Solanum lycopersicum cDNA clone cLEG25P21, mRNA sequence. |
Tags () | None |
Marker Created: | |
---|---|
Marker Updated: | |
Internal Marker Accession: | BE435260 |
Clone | cLEG25P21 |
Comment |
Contact: CUGI Clemson University Genomics Institute Clemson University 100 Jordan Hall, Clemson, SC 29634, USA Email: http://www.genome.clemson.edu/orders/index.html 5 prime sequence. |
Date Created | |
Date Updated | |
Lab Host | SOLR |
Map | |
Note |
Vector: pBluescriptSKmCUadapt; Site_1: EcoR1; Site_2: XhoI; Fruit were harvested at the breaker stage (first sign of lycopene accumulation on the blossom end of the fruit). Fruit were cut in half and the seeds and locules were discarded prior to freezing the pericarp. |
Origin | |
Ref Authors |
Alcala,J., Vrebalov,J., White,R., van der Hoeven,R.S., Holt,I.E., Liang,F., Hansen,T.S., Craven,M.B., Bowman,C.L., Ronning,C.M., Nierman,W., Fraser,C.M., Martin,G.B., Giovannoni,J.J. and Tanksley,S.D. |
Ref Location | Unpublished (2000) |
Ref Medline | |
Ref Pubmed | |
Ref Title | Generation of ESTs from tomato fruit tissue, breaker stage |
Ref Year | 2000 |
CACCGTCAAGAACCTCTCTTCTCCTCTTCTCGCCGCAACTTTCAATCGGGGCTATTGACGTAGGGGAACAGATCGAAAGA
TGTTTGGAAGAGCACCGAAGAAGAGCGATAATACAAAGTATTATGAGATCTTAGGAGTTCCTAAAGCTGCTTCTCATGAA
GA
Map Type | Map Set | Name | Map | Position | Ext. Links | |||
---|---|---|---|---|---|---|---|---|
Genetic | Dvorak 2009 | BNL6.32 | 5D | 30.94-30.94 cM | View Comparative Map | |||
|
Term Type | Term Name | Term Accession | |
---|---|---|---|
Plant Structure | pericarp | PO:0009084 | Search |