![[Home Page]](/images/icons/gramene_logo180new.jpg "[Home Page]"){kind=icon}
Markers Home |
Markers Search |
Browse Map Sets |
SSR Markers Resource |
Microarray Probes |
Help |
Tutorial |
FAQs
Avena sativa RFLP "CDO365"
| ID | 4682 | ||||||
|---|---|---|---|---|---|---|---|
| Name | CDO365 (GRAINGENES PROBE) | ||||||
| Synonyms (6) |
|
||||||
| MAIZEGDB PROBE | p-cdo365 | ||||||
| Type | RFLP | ||||||
| Species | Avena sativa (Oat) [ GR_tax:012534 ] | ||||||
| Germplasm | |||||||
| Description | |||||||
| Tags () | None |
Source/Library
Details
| Marker Created: | |
|---|---|
| Marker Updated: | |
| Internal Marker Accession: | CDO365 |
| DNA Treatment | |
| Source Type | cDNA |
| Source Tissue | seedling leaf |
| Source Treatment | etiolated |
| Vector | pBluescript SK |
| Vector Antibiotic Resistance | Ampicillin |
| Fragment Size | 1.3 |
| Vector Excision Enzyme | EcoRI/XhoI |
| Vector Primers | M13 forward/M13 reverse |
| Overgo1 | SOG0107 |
| Overgo2 |
Database Cross-References (1)
Sequences (1)
Related Sequence (1)
GGCACGAGAAGGAGGGACTTGCTGATTATAGATATTTTCCAGAGCCTGATCTTCCTGAGGTTATTCTCACTACTGAGTAC
ATCGATGAAATTCGCAGTTCAATGCCAGAGCTTCCAGAGGCAAAGCGTAGGCGTTATGAGAACATGGGACTCAGCATGCA
AGATGTTATTTTCCTTGCTAATGACGATAATGTTGCTCATTTCTTTGATTCTACACTTGAGCATGGCGCTGATGCAAAGA
TGGCTGCCAACTGGATCATGGGTGACATCGCTGCTTATCTGAAGGATGAAAAGCTCTCTATTGATGATATCAAATTAACA
CCTCTGGAGCTTCTGAAATGATCGCATCCATAA
Map Positions (19)
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Cornell Diploid 1995 | BNL6.32 | B | 59.9-59.9 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Composite 2004 | BNL6.32 | 6B | 77-77 cM | View Comparative Map | |||
|
||||||||
| QTL | Wheat composite QTL 2004 | BNL6.32 | 6B | 77-77 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| QTL | Minnesota John/Dor F2 QTL 2000 | BNL6.32 | 11 | 0-0 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | TTU CTIR 2000 | BNL6.32 | 11 | 67-67 cM | View Comparative Map | |||
|
||||||||
| TTU IRIR 2000 | BNL6.32 | 11 | 159.6-159.6 cM | View Comparative Map | ||||
|
||||||||
| QTL | CIRAD IR64/Azu DH QTL 2003 | BNL6.32 | 7 | 169.2-169.2 cM | View Comparative Map | |||
|
||||||||
| CTIR CT9993/IR6226 QTL 2000 | BNL6.32 | 11 | 67-67 cM | View Comparative Map | ||||
|
||||||||
| IRRI Mor/CO39 QTL 1994 | BNL6.32 | 11 | 30.4-30.4 cM | View Comparative Map | ||||
|
||||||||
| JNIG W1944/Peik QTL 2002 | BNL6.32 | 11 | 154.6-154.6 cM | View Comparative Map | ||||
|
||||||||
| MU CT9993/IR6226 QTL 2004 | BNL6.32 | 11 | 79-79 cM | View Comparative Map | ||||
|
||||||||
| TNCGEB CT9993/IR6226 QTL 2004 | BNL6.32 | 11 | 52.5-52.5 cM | View Comparative Map | ||||
|
||||||||
| TTU IR58821/IR52561 QTL 2002 | BNL6.32 | 11 | 159.6-159.6 cM | View Comparative Map | ||||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Cornell RFLP 1994 | BNL6.32 | 11 | 88.4-88.4 cM | View Comparative Map | |||
|
||||||||
| Cornell RFLP 2001 | BNL6.32 | 11 | 85.8-85.8 cM | View Comparative Map | ||||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Huazhong RFLP 1997 | BNL6.32 | 11 | 91.9-91.9 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Paterson 2003 | BNL6.32 | H | 43.9-43.9 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | UMC 1998 | BNL6.32 | 4 | 126.3-126.3 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Sequence | Gramene Annotated Nipponbare Sequence 2009 | BNL6.32 | Chr. 11 | 19,565,059-19,565,672 bp | View Comparative Map | |||
|
||||||||
Associations (47)
Associated Ontologies (0)
Images (2)
 |
CDO365 BROWS Autorad: Survey blot of the probe CDO365 for the comparative barley/rice/oat/wheat/sugarcane project |
 |
CDO365 SL Autorad: Survey blot of the probe CDO365 for the BS125/2/BS125/WLO2 population |
