![[Home Page]](/images/icons/gramene_logo180new.jpg "[Home Page]"){kind=icon}
Markers Home |
Markers Search |
Browse Map Sets |
SSR Markers Resource |
Microarray Probes |
Help |
Tutorial |
FAQs
Aegilops speltoides EST "CD491758"
| ID | 4388 | ||||||
|---|---|---|---|---|---|---|---|
| Name |
CD491758 (GenBank Accession  ) |
||||||
| Synonyms (5) |
|
||||||
| GenBank GI | 31416768 | ||||||
| GenBank Version | CD491758.1 | ||||||
| Type | EST | ||||||
| Species | Aegilops speltoides [ GR_tax:012370 ] | ||||||
| Germplasm | |||||||
| Description | WHE2207_E02_J03ZT Aegilops speltoides wheat anther cDNA library Aegilops speltoides cDNA clone WHE2207_E02_J03, mRNA sequence. |
||||||
| Tags () | None |
Source/Library
Details
| Marker Created: | |
|---|---|
| Marker Updated: | |
| Internal Marker Accession: | CD491758 |
| Clone | WHE2207_E02_J03 |
| Comment |
Contact: Olin Anderson US Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center 800 Buchanan Street, Albany, CA 94710, USA Tel: 5105595773 Fax: 5105595818 Email: oandersn@pw.usda.gov This EST was generated by sequencing from the 3' end of the clone. Sequences have been trimmed to remove vector sequence and low quality sequence with phred score less than 20. Seq primer: T7 primer. |
| Date Created | |
| Date Updated | |
| Lab Host | E. coli SOLR |
| Map | |
| Note |
Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at the University of California, Davis (Akhunov). Premeiotic anthers were harvested, total RNA and poly(A) RNA were prepared, from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
| Origin | |
| Ref Authors |
Akhunov,E., Anderson,O.D., Butler,E., Chao,S., Crossman,C., Chin,A., Choi,D.W., Close,T.J., Fenton,R.D., Kianian,P., Lazo,R., Otto,C., Pham,J., Rausch,C.J., Simons,K., Woo,J. and Zhang,D. |
| Ref Location | Unpublished (2003) |
| Ref Medline | |
| Ref Pubmed | |
| Ref Title |
The structure and function of the expressed portion of the wheat genomes - Anther cDNA library from Aegilops speltoides wheat |
| Ref Year | 2003 |
Database Cross-References (0)
Sequences (1)
EST Sequence (1)
TTTTTTTTTTTTTTTTTGGGAAAAACAACAGCATCCTGCATAGCACAGAACAGTAGCATGGAACACTGTACAAGGCGTGA
TTTTGGGCCTTCCACACTTCAACGAAAATATGTACCCTGAAACTTATCTCTAACCCTTACCACTGCACAAAGAACCTGGA
TGCTAACAAATCAGAAGCCCTCACATCGCACGGAACGCAGAAAACAGCATGAAAGAAGAAGAAGAAATAAACTCTCTAAT
GTACTCGTCACCGTCTCCCCGGCCCCTATAGATGCTCCTCGCCGATTCTCACAGAGCCTGGGGATTCGGAACTCCGGACG
GGCTCGGCAGGTTGCTCATGCTCGCGGTTCGTAGGAGCTTGCGGAACTCGGACAGGCTTATCCGCCCGTCCTTGTCGATG
TCGGCCTCCTCCAGCAATGGCTCGATGGATCCCTTTAAGCCCGTGTGCATTCTAAGTTCATCGGGGGTGATGTATCCATC
ACCATCCAGATCAAATTTGCTGAAAGCAGCTTGGCAGCGGAGGCCCCACCTTTCAGAGTCCAGCTCAGCCATCTGATGTA
TGTGGAGAGTTGCCGCAACAAACTCTTTGAAGTCGACAAGGCCATCCGTGTTGCTGTCGATCGCTTGAATGATCTCGAGA
ACACGAGGGCCCTTCAATCTCCAAGGAAGATCCTTCGCAAGGGCATGCCGCATTTCTTCA
Map Positions (2)
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Dvorak 2009 | BNL6.32 | 6D | 57.87-57.87 cM | View Comparative Map | |||
|
||||||||
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Sequence | Gramene Annotated Nipponbare Sequence 2009 | BNL6.32 | Chr. 2 | 1,393,118-1,393,938 bp | View Comparative Map | |||
|
||||||||
Associations (3)
| Species | Type | Name | Assoc. Type |
|---|---|---|---|
| Triticum aestivum | Breakpoint Interval | 6AS5-0.65-1.00 | Wheat-EST-BI |
| Triticum aestivum | Breakpoint Interval | 6BS5-0.76-1.05 | Wheat-EST-BI |
| Triticum aestivum | Breakpoint Interval | 6DS4-0.79-0.99 | Wheat-EST-BI |
Associated Ontologies (1)
| Term Type | Term Name | Term Accession | |
|---|---|---|---|
| Plant Structure | anther | PO:0009066 | Search |
Images (0)
