ID | 3894 | ||||||||
---|---|---|---|---|---|---|---|---|---|
Name | BE442876 (GenBank Accession ) | ||||||||
Synonyms (8) |
|
||||||||
GenBank GI | 9442398 | ||||||||
GenBank Version | BE442876.1 | ||||||||
Type | EST | ||||||||
Species | Triticum aestivum (Wheat) [ GR_tax:014341 ] | ||||||||
Germplasm | |||||||||
Description | WHE1107_C07_F13ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1107_C07_F13, mRNA sequence. |
||||||||
Tags () | None |
Marker Created: | |
---|---|
Marker Updated: | |
Internal Marker Accession: | BE442876 |
Clone | WHE1107_C07_F13 |
Comment |
Contact: Olin Anderson US Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center 800 Buchanan Street, Albany, CA 94710, USA Tel: 5105595773 Fax: 5105595818 Email: oandersn@pw.usda.gov Sequence have been trimmed to remove vector sequence and low quality sequence with phred score less than 20 Seq primer: Stratagene SK primer. |
Date Created | |
Date Updated | |
Lab Host | E. coli DH10B |
Map | |
Note |
Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
Origin | |
Ref Authors |
Anderson,O.D., Chao,S., Choi,D.W., Close,T.J., Fenton,R.D., Han,P.S., Hsia,C.C., Kang,Y., Lazo,G.R., Miller,R., Nguyen,H.T., Rausch,C.J., Seaton,C.L., Tong,J.C. and Zhang,D. |
Ref Location | Unpublished (2000) |
Ref Medline | |
Ref Pubmed | |
Ref Title |
The structure and function of the expressed portion of the wheat genomes - Normalized root cDNA library |
Ref Year | 2000 |
TTCGACGACGAAGTGCATATTAGTCGATGAACATGACAATGTCATTGGCCACGAGTCTAAGTATAACTGCCATCTCACTG
GAAAAGATAGAATCAGGGCATGCCCTTCACAGAGCGTTCAGTGTTTTTCTTTTCAACTCCAAATATGAATTGTTACTTCA
GCAACGGTCTACGACAAAAGTGACATTTCCACTTGTCTGGACAAACACTTGCTGTAGCCACCCTTTACACCGTGAGTCTG
AGCTCATTGAGGAGAACTGCCAAGGGGTCAGAAATGCAGCACAGAGGAAACTATTTGACGAACTGGGAATACAGGCTGAA
GATTTACCAGTTGACCAATTCATCCCACTCGGGAAGATGCTTTACAAGGCTCCATCTGATGGAAAATGGGGCGAACACGA
ACTGGACTACCTCCTGTTCATGGTTCGGGACGTGAAGCTCAACCCAAACCCCGAAGAAGTGTCCGACGTCAAGTACGTGA
ACCGTGACGAGCTGAAGCAGCTGATT
Map Type | Map Set | Name | Map | Position | Ext. Links | |||
---|---|---|---|---|---|---|---|---|
Genetic | Dvorak 2009 | BNL6.32 | 1D | 72.4-72.4 cM | View Comparative Map | |||
|
Map Type | Map Set | Name | Map | Position | Ext. Links |
---|---|---|---|---|---|
Sequence | Gramene Annotated Nipponbare Sequence 2009 | BNL6.32 | Chr. 5 | 20,149,198-20,150,711 bp | |
|
Species | Type | Name | Assoc. Type |
---|---|---|---|
Triticum aestivum | Breakpoint Interval | 1AL3-0.61-1.00 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | 1BL1-0.47-0.69 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | 1DL2-0.41-1.00 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | C-2AS5-0.78 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | C-2DS1-0.33 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | C-2BS1-0.53 | Wheat-EST-BI |
Term Type | Term Name | Term Accession | |
---|---|---|---|
Plant Structure | root | PO:0009005 | Search |