ID | 3884 | ||||||
---|---|---|---|---|---|---|---|
Name | BE404399 (GenBank Accession ) | ||||||
Synonyms (5) |
|
||||||
GenBank GI | 9363867 | ||||||
GenBank Version | BE404399.1 | ||||||
Type | EST | ||||||
Species | Triticum aestivum (Wheat) [ GR_tax:014341 ] | ||||||
Germplasm | |||||||
Description | WHE0441_G04_M07ZS Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE0441_G04_M07, mRNA sequence. |
||||||
Tags () | None |
Marker Created: | |
---|---|
Marker Updated: | |
Internal Marker Accession: | BE404399 |
Clone | WHE0441_G04_M07 |
Comment |
Contact: Olin Anderson US Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center 800 Buchanan Street, Albany, CA 94710, USA Tel: 5105595773 Fax: 5105595818 Email: oandersn@pw.usda.gov Sequence have been trimmed to remove vector sequence and low quality sequence with phred score less than 20 Seq primer: Strategene SK primer. |
Date Created | |
Date Updated | |
Lab Host | E. coli SOLR |
Map | |
Note |
Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
Origin | |
Ref Authors |
Anderson,O.D., Chao,S., Choi,D.W., Close,T.J., Fenton,R.D., Han,P.S., Hsia,C.C., Kang,Y., Lazo,G.R., Miller,R., Rausch,C.J., Seaton,C.L. and Tong,J.C. |
Ref Location | Unpublished (2000) |
Ref Medline | |
Ref Pubmed | |
Ref Title | The structure and function of the expressed portion of the wheat genomes |
Ref Year | 2000 |
AAGGTAAACAAGCCGGGGGACAAGACATTTTCTCTCAGCATCTCTCATCTTAGGGCCATCCTTCTCAGTAGATTTGTGCT
TGCACACTTTGGCCCTAAAGCACGCAGGTGTCGAACTTTCATCAATTGGTTCTGAAAGAAAATTTACACTGGTTGTTGGT
GTCCACCAAGGGCGTGCCTCGAGATCTTCATTA
Map Type | Map Set | Name | Map | Position | Ext. Links | |||
---|---|---|---|---|---|---|---|---|
Genetic | Dvorak 2009 | BNL6.32 | 1D | 64.24-64.24 cM | View Comparative Map | |||
|
Map Type | Map Set | Name | Map | Position | Ext. Links |
---|---|---|---|---|---|
Sequence | Gramene Annotated Nipponbare Sequence 2009 | BNL6.32 | Chr. 5 | 16,198,621-16,198,682 bp | |
|
Species | Type | Name | Assoc. Type |
---|---|---|---|
Triticum aestivum | Breakpoint Interval | 1AL1-0.17-0.61 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | 1BL6-0.32-0.47 | Wheat-EST-BI |
Triticum aestivum | Breakpoint Interval | 1DL2-0.41-1.00 | Wheat-EST-BI |
Term Type | Term Name | Term Accession | |
---|---|---|---|
Plant Structure | root | PO:0009005 | Search |