![[Home Page]](/images/icons/gramene_logo180new.jpg "[Home Page]"){kind=icon}
Markers Home |
Markers Search |
Browse Map Sets |
SSR Markers Resource |
Microarray Probes |
Help |
Tutorial |
FAQs
Triticum aestivum EST "BE590674"
| ID | 3796 | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name |
BE590674 (GenBank Accession  ) |
||||||||
| Synonyms (7) |
|
||||||||
| GenBank GI | 9845747 | ||||||||
| GenBank Version | BE590674.1 | ||||||||
| Type | EST | ||||||||
| Species | Triticum aestivum (Wheat) [ GR_tax:014341 ] | ||||||||
| Germplasm | |||||||||
| Description | WHE0856_E06_I12ZS Wheat 20-45 DAP spike cDNA library Triticum aestivum cDNA clone WHE0856_E06_I12, mRNA sequence. |
||||||||
| Tags () | None |
Source/Library
Details
| Marker Created: | |
|---|---|
| Marker Updated: | |
| Internal Marker Accession: | BE590674 |
| Clone | WHE0856_E06_I12 |
| Comment |
Contact: Olin Anderson US Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center 800 Buchanan Street, Albany, CA 94710, USA Tel: 5105595773 Fax: 5105595818 Email: oandersn@pw.usda.gov Sequence have been trimmed to remove vector sequence and low quality sequence with phred score less than 20 Seq primer: Stratagene SK primer. |
| Date Created | |
| Date Updated | |
| Lab Host | E. coli SOLR |
| Map | |
| Note |
Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 20 DAP and seeds at 30 to 45 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). |
| Origin | |
| Ref Authors |
Anderson,O.D., Chao,S., Choi,D.W., Close,T.J., Fenton,R.D., Han,P.S., Hsia,C.C., Kang,Y., Lazo,G.R., Miller,R., Rausch,C.J., Seaton,C.L. and Tong,J.C. |
| Ref Location | Unpublished (2000) |
| Ref Medline | |
| Ref Pubmed | |
| Ref Title |
The structure and function of the expressed portion of the wheat genomes - 20-45 DAP spike cDNA library |
| Ref Year | 2000 |
Database Cross-References (0)
Sequences (1)
EST Sequence (1)
GCAACAACCACCATTTTCGCAGCAACAACCACCATTTTCTCAGCAGCAGCAACAACCACCATTTTCGCAGCAACAACAAC
AACCAATTCTACTGCAACAACCACCATTTTCACAACACCAACAACCAGTTCTACCGCAACAACAAATACCATCTGTTCAG
CCATCTATCTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAATGCAGCCCTGTGGCAATGCCACAAAGTCT
TGCTAGGTCGCAAATGTTGTGGCAGAGTAGTTGCCATGTGATGCAGCAACAATGTTGCCGGCAGCTGCCGCAAATCCCCG
AACAATCACGCTACGATGCAATCCGTGCCATCATCTACTCGATCGTCCTACAAGAACAACAACATGGTCAGGGTTTGAAC
CAACCTCAGCAGCAACAACCCCAACAGTCGGTCCAAGGTGTCTCCCAACCCCAACAACAACAGAAGCAGCTCGGACAGTG
TTCTTTCCAACAACCTCAACAACAACAACTGGGTCAATGGCCTCAACAACAACAGGTACCCCA
Map Positions (1)
| Map Type | Map Set | Name | Map | Position | Ext. Links | |||
|---|---|---|---|---|---|---|---|---|
| Genetic | Dvorak 2009 | BNL6.32 | 1D | 11.14-11.14 cM | View Comparative Map | |||
|
||||||||
Associations (3)
| Species | Type | Name | Assoc. Type |
|---|---|---|---|
| Triticum aestivum | Breakpoint Interval | 1AS3-0.86-1.00 | Wheat-EST-BI |
| Triticum aestivum | Breakpoint Interval | 1BS.sat18-0.50-1.00 | Wheat-EST-BI |
| Triticum aestivum | Breakpoint Interval | 1DS5-0.70-1.00 | Wheat-EST-BI |
Associated Ontologies (0)
Images (0)
