ID | 27752 | ||
---|---|---|---|
Name | T14655 (GenBank Accession ) | ||
Synonyms (2) |
|
||
GenBank GI | 440634 | ||
GenBank Version | T14655.1 | ||
MaizeGDB cDNA - EST | p-5C03G12 | ||
Type | EST | ||
Species | Zea mays (Maize) [ GR_tax:014450 ] | ||
Germplasm | |||
Description | 05c03g12-t7 membrane-free polysomes from endosperm Zea mays cDNA clone 05c03g12 5' end similar to GTP-binding protein, mRNA sequence. |
||
Tags () | None |
Marker Created: | |
---|---|
Marker Updated: | |
Internal Marker Accession: | T14655 |
Clone | 05c03g12 |
Comment |
Contact: The Maize cDNA Project Helentjaris TG (primary contact) Dept. of Plant Sciences University of Arizona Dept. of Plant Sciences, University of Arizona, Tucson, AZ,85721 ph: 602-6218-746 fax: 602-621-7186 E-mail: helnjars@ccit.arizona.edu Chris Baysdorfer Department of Biological Sciences, School of Science California State University, Hayward Hayward, CA 94542 ph: 510-881-3459 fax: 510-727-2035 E-mail: cbaysdor@s1.csuhayward.edu Rob Ferl Interdisciplinary Center for Biotechnology Research DNA Sequencing Core University of Florida P.O. Box 100695 Gainesville, FL 32611-0695 ph: 904-392- 1928, ext. 301 fax: 904-392-4072 E-mail: robferl@nervm.nerdc.ufl.edu Seq primer: T7. |
Date Created | |
Date Updated | |
Lab Host | DH10B |
Map | |
Note |
Vector: ZipLox; Site_1: SalI; Site_2: NotI; ds-cDNA was prepared from oligo-dT selected mRNA by priming with a NotI oligo- dT oligomer and then adding the second strand to RNase-nicked DNA:RNA hybrid with DNA PolI. SalI adaptors were added to the ends, the ds-cDNAs were then digested with NotI and size-selected. These were directionally-cloned into the ZipLox phage vector, excised as plasmids, and then individually analyzed. |
Origin | |
Ref Authors |
Shen,B., Carneiro,N., Torres-Jerez,I., Stevenson,R., McCreery,T., Helentjaris,T., Baysdorfer,C., Almira,E., Ferl,R., Habben,J. and Larkins,B. |
Ref Location | Plant Mol Biol 26, 1085-1101 (19 |
Ref Medline | |
Ref Pubmed | 7811968 |
Ref Title | Partial sequencing and mapping of clones from two maize cDNA libraries |
Ref Year | 1994 |
NCAGATCCACACACATCCGCATCCCTCTCTCCTCGGTTTCCTCTCCCACCACCAACCCCCAGATCGCAGCGATCTCCGCC
GCCGCCCTCTCTGGGATTCCGCGCGACAAAGTCAGGCGTAGAGGCTCCAGGAGGAGGAGGGAGGCGCAGAGGGCGGGTGG
GGGAGATGTTCCTCTGGGACTGGTTCTACGGGGTGCTGGCCTCCCTCGGCCTGTGGCAGAAGGAGGCCAAGTTCCTCTTC
CTTGGCCTCGACAACGTCGGTAAGACCACGTTGTTCCACATGCTCAAGGACGAGCGGTTGG
Map Type | Map Set | Name | Map | Position | Ext. Links | |||
---|---|---|---|---|---|---|---|---|
Genetic | BNL 1996 | BNL6.32 | 1 | 168.5-168.5 cM | View Comparative Map | |||
|
Map Type | Map Set | Name | Map | Position | Ext. Links |
---|---|---|---|---|---|
Sequence | Gramene Annotated Nipponbare Sequence 2009 | BNL6.32 | Chr. 1 | 13,285,314-13,285,558 bp | |
|