grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Armenia" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 46.       of 2 | Next

[ Download ]

Germplasm
Accession Name
Germplasm
Accession
Number
Subsp.
& subtaxa
Country of
Origin
Stock
Number
Locus
name
 Genotype
View All Genotypes on
Marker
AL8/78 Armenia   Armenia 1 BE399999_141-1D -------------------- View all "BE399999_141-1D" genotypes
AL8/78 Armenia   Armenia 1 BE399999_141-1D C View all "BE399999_141-1D" genotypes
AL8/78 Armenia   Armenia 1 BE399999_98-1D -------------------- View all "BE399999_98-1D" genotypes
AL8/78 Armenia   Armenia 1 BE399999_98-1D G View all "BE399999_98-1D" genotypes
AL8/78 Armenia   Armenia 1 BE423871_59-1D C View all "BE423871_59-1D" genotypes
AL8/78 Armenia   Armenia 1 BE423871_59-1D -------------------- View all "BE423871_59-1D" genotypes
AL8/78 Armenia   Armenia 1 BE443068_320-1A C View all "BE443068_320-1A" genotypes
AL8/78 Armenia   Armenia 1 BE443068_320-1A -------------------- View all "BE443068_320-1A" genotypes
AL8/78 Armenia   Armenia 1 BE490041_127-1D GCACAGCCCCTGTGGCCACC View all "BE490041_127-1D" genotypes
AL8/78 Armenia   Armenia 1 BE490041_127-1D A View all "BE490041_127-1D" genotypes
AL8/78 Armenia   Armenia 1 BE490041_290-1D T View all "BE490041_290-1D" genotypes
AL8/78 Armenia   Armenia 1 BE490041_290-1D GCACAGCCCCTGTGGCCACC View all "BE490041_290-1D" genotypes
AL8/78 Armenia   Armenia 1 BE490041_368-1D C View all "BE490041_368-1D" genotypes
AL8/78 Armenia   Armenia 1 BE490041_368-1D GCACAGCCCCTGTGGCCACC View all "BE490041_368-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_171-1D A View all "BE495542_171-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_171-1D -------------------- View all "BE495542_171-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_272-1D T View all "BE495542_272-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_272-1D -------------------- View all "BE495542_272-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_54-1D A View all "BE495542_54-1D" genotypes
AL8/78 Armenia   Armenia 1 BE495542_54-1D -------------------- View all "BE495542_54-1D" genotypes
AL8/78 Armenia   Armenia 1 BE497109_172-1D A View all "BE497109_172-1D" genotypes
AL8/78 Armenia   Armenia 1 BE497109_172-1D -------------------- View all "BE497109_172-1D" genotypes
AL8/78 Armenia   Armenia 1 BE497109_61-1D C View all "BE497109_61-1D" genotypes
AL8/78 Armenia   Armenia 1 BE497109_61-1D -------------------- View all "BE497109_61-1D" genotypes
AL8/78 Armenia   Armenia 1 BE497109_9-1D T View all "BE497109_9-1D" genotypes
[ Download ]