grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AY244508_316-5A" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 52.       of 3 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
CIMMYT 161725_0 CIMMYT   Mexico 1 AY244508_316-5A --GGCTGAGA-GTAGCTGTC View all "CIMMYT 161725_0" genotypes
CIMMYT 161725_0 CIMMYT   Mexico 1 AY244508_316-5A G View all "CIMMYT 161725_0" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 AY244508_316-5A G View all "CIMMYT 62056_4" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 AY244508_316-5A ---------AGGTAGCTGTC View all "CIMMYT 62056_4" genotypes
RL5402 Eric Kerber   Unknown 1 AY244508_316-5A G View all "RL5402" genotypes
RL5402 Eric Kerber   Unknown 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "RL5402" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A G View all "W7984" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A GGTCAACTTGTCATGAAGCC View all "W7984" genotypes
405a Iran spelta Iran 1 AY244508_316-5A -------------------- View all "405a" genotypes
405a Iran spelta Iran 1 AY244508_316-5A A View all "405a" genotypes
Chinese Spring China   China 1 AY244508_316-5A G View all "Chinese Spring" genotypes
Chinese Spring China   China 1 AY244508_316-5A -------------AGCTGTC View all "Chinese Spring" genotypes
PI 119325 Turkey   Turkey 1 AY244508_316-5A G View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 AY244508_316-5A G View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 119325" genotypes
Yecora Rojo CIMMYT   Mexico 1 AY244508_316-5A G View all "Yecora Rojo" genotypes
Yecora Rojo CIMMYT   Mexico 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "Yecora Rojo" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AY244508_316-5A G View all "Yangxian Yangqianmai" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AY244508_316-5A ---CTCGAGAGGTAGCTGTC View all "Yangxian Yangqianmai" genotypes
IWA 10993 Iran   Iran 1 AY244508_316-5A G View all "IWA 10993" genotypes
IWA 10993 Iran   Iran 1 AY244508_316-5A -----------------GTC View all "IWA 10993" genotypes
PI 410595 Pakistan compactum Pakistan 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 410595" genotypes
PI 410595 Pakistan compactum Pakistan 1 AY244508_316-5A G View all "PI 410595" genotypes
PI 350731 Austria compactum Austria 1 AY244508_316-5A G View all "PI 350731" genotypes
[ Download ]